DETAILS: | Gas station, (Edit) |
---|---|
Address: | 362 Putty Rd, Wilberforce NSW 2756, Australia |
Postal code: | 2756 |
Phone: | (02) 4576 3401 |
Website: | https://www.bp.com/en_au/australia.html |
BP in Wilberforce, NSW, 2756. Business contact details for BP including phone number, reviews & map location - TrueLocal ... (02) 4576 3401. Brands. BP; Is this your ...
https://www.truelocal.com.au/business/bp/wilberforceMaps and GPS directions to BP Wilberforce and other BP Fuel locations in Australia. Find your nearest BP Fuel. BP has worked in Australia since 1920. Today, BP is involved in a whole range of activities, such as exploring natural gas and crude oil resources.
https://www.gps-data-team.info/whereis/australia/petrol/BP_Fuel/BP-Wilberforce.htmlBp North Wilberforce (02) 4576 3401. 362 Singleton Road, Wilberforce NSW 2756. Save Contact. Share via SMS × , ...
https://www.whitepages.com.au/bp-north-wilberforce-12037409/wilberforce-nsw-12037410B(02) 4576 3401 . Send To Mobile; Email (02) 4576 3401 . Freeman's Reach Service & Tyre Centre. Petrol Stations - Freemans Reach, NSW 2756 ... BP Express Great Western Hwy
https://www.goguide.com.au/find/Petrol-Stations-&-Garages/Marsden-Park-NSWbp Wilberforce is a LPG station in Australia. Find or add latest autogas prices. ... Tel: 02 4576 3401. Station status. This station was confirmed in the last 3 months.
https://www.mylpg.eu/stations/australia/station/bp-Wilberforce-1A3DBDC5-AB80-D9F7-1DF2-E6348F42132F362 Putty Road, Wilberforce NSW 2756, 2756 (02) 4576 3401 Today's fuel pricing at BP Wilberforce We are actively working towards displaying near real-time fuel pricing for this and other NSW fuel stations.
https://fuelprice.io/station/bp-wilberforce/Fast Delivery for NSN Parts 5935-01-196-3285, 5935-01-196-3401, 5935-01-196-3648
https://www.csgparts.com/connectors-electrical-fsc-5935/page/4600(02) 4576 3401. Send to Send to mobile ... BP Shalvey. Service Stations - Shalvey, NSW 2770. No Opening Hours Provided 13.3km.
https://www.yellowpages.com.au/find/service-stations/clarendon-nsw-2756(02) 4576 3401. Send to Send to mobile. Easman's Service Station. Service Stations - Pitt Town, NSW 2756. ... BP Maraylya. Service Stations - Maraylya, NSW 2765.
https://www.yellowpages.com.au/find/service-stations/wilberforce-nsw-275654 412 bp SpeS1-6 TTAAAAGGATTCTGCAAAGTTCT Helitron-1 TACTCTCCTTCCCGTCTCCTG 58 941 bp Helitron-2 CTTCTTGCAACCCAAACACTG Helitron-3 ATAAAATGTTGGATCTGTCGAAGC 55 764 bp Helitron-4 CCCTGCAGAAAATTCTTGTTTATC 10KHelitron-1 TGCGTTAAGATTTGTTCATGTGC 55 810 bp 10KHelitron-2 ATCACAAACACGAATCGAGACAA 10KHelitron-3 GGCACGAATGTAAAATCAGGTTAA 55 773 bp
https://images.nature.com/original/nature-assets/srep/2016/160921/srep33785/extref/srep33785-s1.pdfThe phone number for BP is (02) 4576 3401.
BP is located at 362 Putty Rd, Wilberforce NSW 2756, Australia
The website (URL) for BP is: https://www.bp.com/en_au/australia.html