Address: | 1, 167 Logan Rd, Woolloongabba QLD 4102, Australia |
---|---|
Postal code: | 4102 |
Phone: | (07) 3339 5102 |
Website: | http://mlea.com.au/ |
Monday: | 9:00 AM – 5:00 PM |
---|---|
Tuesday: | 9:00 AM – 5:00 PM |
Wednesday: | 9:00 AM – 5:00 PM |
Thursday: | 9:00 AM – 5:00 PM |
Friday: | 9:00 AM – 5:00 PM |
Saturday: | Closed |
Sunday: | Closed |
There are no reviews yet!
You can review this Business and help others by leaving a comment. If you want to share your thoughts about MLEA, use the form below and your opinion, advice or comment will appear in this space.
At MLEA, our core business is providing expert opinion to support the fair resolution of personal injury compensation claims - it's something we've excelled at for almost 30 years. MLEA is known for the quality, reliability and objectivity of our reports and assessments.
reception@mlea.com.au. www.mlea.com.au.
Phone 07 3339 5102. Make a booking. Flexibility and expertise. At MLEA, we've excelled at expert medicolegal opinions for almost 30 years. Additionally, our specialist clinicians work with employers to provide pre-employment evaluations and workplace assessments and plans.
Phone 07 3339 5102. Make a booking. The mlea story. MLEA (Medicolegal Experts Australia) was founded in 2011 by respected Occupational Therapist, Vanessa Aitken.
Phone 07 3339 5102. Make a booking. Building a safe, productive workplace. MLEA employment services are a great way to invest in the health and safety of your biggest asset - your people.
NOTE: MLEA Tuition fees will cover the course instruction and lunch if the course is a full day or more in length. For MLEA Professional Program course questions, registration, or to schedule a course on the MLEA 06febAll Day07INVESTIGATING SEXUAL ASSAULT Event Organized By: Kayla Bragg.
View and Download York MLCA-MLHA-07-24 installation & owner's manual online. MINISPLIT HIGH WALL air conditioner. TECHNICAL SPECIFICATION Technical Specifications : Master Gold ''R22'' - 60 Hz Indoor Models Unit MLEA07 MLKA07 MLEA09...
Последние твиты от Proyecto Juventud (@MLEA_PJ). Proyecto Juventud is @Mujereslatinas youth program. Serving teens ages 12-18 years old we aim to cultivate the next generation of Latin@ young leaders.
BKK23550 ([gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATTCAGTGATCCTCCC, downstream forward: _UP4_TAAATGTAGCTAAACAGCAC.
Mlea Tnä is on Facebook. Join Facebook to connect with Mlea Tnä and others you may know. Facebook gives people the power to share and makes the world...